If you have been reading about thymosin beta-4 and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2026-04-02. Where a claim depends on a specific study, the study is described rather than over-claimed.
Identity and purity checks for peptide material typically combine reversed-phase high-performance liquid chromatography with mass measurement, since retention time alone cannot confirm a sequence. Mass measurement verifies the expected molecular mass within instrument tolerance, while chromatographic peak area provides a purity estimate. Anti-doping analysis of urine uses related but more sensitive workflows, sometimes after solid-phase extraction. For research material, batch documentation, certificate content, and independent testing are common points of scrutiny, because supply chains outside pharmaceutical regulation vary widely in the paperwork they provide.
Reconstitution of a lyophilized peptide is normally done with sterile water or a suitable buffer under aseptic conditions. Adding solvent down the vial wall and allowing gentle dissolution instead of vigorous vortexing reduces the chance of aggregation, which can lower the effective concentration of the resulting solution. Concentrated stocks are usually diluted into working buffer shortly before use. Because no standard preparation protocol exists for TB-500 specifically, laboratories adapt general peptide handling practice, and reported results may reflect differing preparation choices.
The most frequently cited identity is a seven-residue fragment with the sequence LKKTETQ, taken from the actin-binding domain of the parent protein. A separate molecule, N-acetyl-seryl-aspartyl-lysyl-proline, often shortened to Ac-SDKP, derives from the same protein's N-terminal region and appears in overlapping literature. Reported molecular masses therefore differ between sources, and a mass value on its own does not establish which fragment is present. Confirmation requires a defined sequence rather than a single number.
Research interest in thymosin beta-4 fragments centres on actin sequestration, cell migration and tissue repair models. Most published work uses cultured cells or animal wound and cardiac preparations, and findings are generally described as preliminary. No fragment of this protein has been approved as a therapeutic product by major regulators. Reviews of the field note inconsistent dosing, delivery routes and outcome measures across studies, which complicates direct comparison. The material is best understood as a laboratory reagent with an active but unresolved research literature.
| Property | Value | Notes |
|---|---|---|
| Reconstitution solvent | Sterile water or aqueous buffer | Aseptic technique recommended |
| Post-reconstitution storage | 2–8 °C short term; frozen for longer periods | Avoid repeated freeze-thaw cycles |
| Typical purity assay | Reversed-phase HPLC | Peak area used to estimate purity |
| Identity confirmation | Mass measurement | Compares observed value with expected mass |
| Main degradation routes | Hydrolysis and oxidation | Accelerated by heat and extreme pH |
The regulatory position is broadly consistent across major jurisdictions: no thymosin beta-4 fragment is an approved medicine, and laboratory material is commonly labelled as not intended for human consumption. Anti-doping rules in sport list thymosin beta-4 and its fragments among prohibited peptide hormones. Because these products travel through research-chemical channels rather than pharmaceutical supply chains, quality varies considerably between vendors. Independent testing of identity, purity and sterility is the only dependable check, and a certificate of analysis describes one batch rather than a supplier's whole catalogue.
Lyophilized peptide powder is normally held desiccated at −20 °C, with −80 °C used for longer storage periods. Allowing a sealed vial to reach room temperature before opening is standard practice, because condensation forming on cold powder introduces moisture. Once dissolved, solutions are typically kept cold and shielded from light. Repeated freeze-thaw cycles are avoided because they encourage aggregation and gradual loss of material. These conventions are general to synthetic peptides rather than unique to any one sequence.
Thymosin beta-4 itself is a natural peptide of 43 residues found in many cell types and body fluids. Its best-characterised function is binding and sequestering actin monomers, which influences cytoskeletal dynamics. The sequence most often associated with TB-500, LKKTETQ, corresponds to part of that actin-binding region. A different fragment, Ac-SDKP, is also derived from the same parent peptide and is studied in its own right, which is one reason discussions of thymosin fragments can become confusing. The two are structurally distinct and are not interchangeable.
Interest in the fragment grew during the 1990s and 2000s, when it moved from laboratory work into sports and supplement markets. Anti-doping bodies added thymosin beta-4 fragments to prohibited lists, and a small number of adverse analytical findings have been reported in competition testing. Published controlled human trials remain scarce. Most mechanistic evidence comes from cell culture and animal models, and those studies examine endpoints such as cell migration, wound closure and inflammation markers. That evidence supports research interest but does not establish clinical benefit, and broad regenerative claims should be read as unverified.
Material is normally supplied as a lyophilised powder in a sealed vial. The powder is hygroscopic, so exposure to humid air leads to water uptake, caking and gradual loss of the fluffy texture that indicates a good freeze-dry. Vials are best kept sealed with desiccant, protected from light and stored cold. Letting a cold vial warm to room temperature before opening reduces condensation on the contents. Purity is normally reported from a chromatographic run, and that figure applies to the batch as tested rather than to the vial after repeated opening.
Once dissolved, the peptide is far less stable than the dry powder. Aqueous solutions are subject to hydrolysis, oxidation at susceptible residues and gradual loss of material through adsorption onto glass and plastic surfaces. Terminal glutamine can cyclise under some conditions, producing a related species that complicates purity assessment. Dilute solutions tend to lose a larger fraction of material to surfaces than concentrated ones. Buffers, pH and ionic strength all influence the rate of change, so stability figures are only meaningful when those parameters are stated alongside the storage interval.
TB-500 is a synthetic heptapeptide with the sequence Ac-LKKTETQ. It corresponds to a short N-terminal region of thymosin beta-4, a 43-amino-acid protein found in many cell types. The fragment contains an actin-binding motif, which is one reason it appears in laboratory studies of cell migration and cytoskeletal dynamics. TB-500 is not the full-length protein and is produced as a research chemical rather than an approved therapeutic agent. Its molecular weight is approximately 889 Da.
Several names appear in scientific and commercial contexts for this peptide. The label TB-500 is informal and does not follow standard biochemical nomenclature. Research articles more often describe the compound as a thymosin beta-4 fragment, Tβ4 fragment, or by its sequence Ac-LKKTETQ. Confusing TB-500 with full-length thymosin beta-4 can lead to incorrect assumptions about activity because the fragment lacks the remaining residues of the parent protein. The relationship between fragment and parent protein remains an active area of study.
Regulatory status differs by country, but TB-500 is not an approved pharmaceutical in major jurisdictions. It is commonly sold as a research chemical for laboratory use, which places responsibility for identity and purity on the supplier and the laboratory. Published human data are limited, and most reports involve preclinical models or cell culture. Questions about whether the fragment mimics all actions of thymosin beta-4, and under which conditions, remain open. Independent verification of any material is therefore a practical requirement in research settings.
Clinicians use drug detoxification to reduce or relieve withdrawal symptoms while helping an addicted person adjust to living without drug use. Drug detoxification does not aim to treat addiction but rather represents an early step within long-term treatment. Detoxification may be achieved drug-free or may use medications as an aspect of treatment. Often drug detoxification and treatment will occur in a community program that lasts several months and takes place in a residential setting rather than in a medical center. Drug detoxification varies depending on the location of treatment, but most detox centers provide treatment to avoid the symptoms of physical withdrawal from alcohol and from other drugs. Most also incorporate counseling and therapy during detox to help with the consequences of withdrawal.
=== Tolerance === Mescaline is associated with rapid tolerance development, including cross-tolerance with other psychedelics like LSD and psilocybin. This tolerance is apparent within a few days and resets after 3 or 4 days of abstinence.
=== Designed proteins === Numerous protein structures are the result of rational design and do not exist in nature. Proteins can be designed from scratch (de novo design) or by making calculated variations on a known protein structure and its sequence (known as protein redesign). Rational protein design approaches make protein-sequence predictions that will fold to specific structures. These predicted sequences can then be validated experimentally through methods such as peptide synthesis, site-directed mutagenesis, or Artificial gene synthesis.
=== Phase 3 === Aripiprazole (Abilify; OPC-14597) – atypical antipsychotic (non-selective monoamine receptor modulator) [2] Cyclobenzaprine (KRL-102; TNX-102; Tonmya) – tricyclic antidepressant (monoamine reuptake inhibitor and monoamine receptor modulator) [3]
Sources: en.wikipedia.org
This model attempts to use these factors to predict the impact of lifestyle changes and genetics for the evolution of the MASLD pathology. Many researchers describe MASLD as a multisystem disease, as it impacts and is influenced by organs and regulatory pathways other than the liver. The accumulation of senescent cells in the liver is seen in persons with MASLD. In mice, liver senescent hepatocytes result in increased liver fat deposition. Treatment of MASLD mice with senolytic agents has been shown to reduce hepatic steatosis. Based on gene knockout studies in murine models, it has been suggested that, among many other pathogenic factors, TGF beta signals may be crucially involved in promoting the progression of MASH.
=== Available forms === Trazodone is provided as the hydrochloride salt and is available in the form of 50 mg, 100 mg, 150 mg, and 300 mg oral tablets. In Italy, it is also available as an oral solution (Trittico 60 mg/mL) with a dosing pipette marked at 25 mg and 50 mg. An extended-release oral tablet formulation at doses of 150 mg and 300 mg is also available.
On May 5, 2026, Rubio held a meeting with SOUTHCOM commander General Francis L. Donovan regarding Operation Southern Spear with a map of Cuba on the background. When asked about why he posed a picture with the map of Cuba, he had clarified saying "Cuba is under the Southern Command, you know it's the closest part. Our ambassadors were all over the Western Hemisphere. I met with the general who just took command of SOUTHCOM, and there was a map of Cuba behind us. I thought it would be fitting to take a picture in front of it because it's the closest to the United States within SOUTHCOM.". On May 20, 2026, USS Nimitz (CVN-68) and her Carrier Strike Group along with USS Gridley (DDG-101) and USNS Patuxent had arrived in the Caribbean.
==== Hydrogen ==== The isotopic reference frame of Standard Mean Ocean Water (SMOW) was established by Harmon Craig in 1961 by measuring δ2H and δ18O in samples of deep ocean water previously studied by Epstein & Mayeda (1953). Originally SMOW was a purely theoretical isotope ratio intended to represent the mean state of the deep ocean. In the initial work the isotopic ratios of deep ocean water were measured relative to NBS-1, a standard derived from the steam condensate of Potomac River water. Notably, this means SMOW was originally defined relative to NBS-1, and there was no physical SMOW solution. Following the advice of an IAEA advisory group meeting in 1966, Ray Weiss and Harmon Craig made an actual solution with the isotopic values of SMOW which they called Vienna Standard Mean Ocean Water (VSMOW). They also prepared a second hydrogen isotope reference material from firn collected at the Amundsen-Scott South Pole Station, initially called SNOW and later called Standard Light Antarctic Precipitation (SLAP). Both VSMOW and SLAP were distributed beginning in 1968. The isotopic characteristics of SLAP and NBS-1 were later evaluated by interlaboratory comparison through measurements against VSMOW (Gonfiantini, 1978). Subsequently, VSMOW and SLAP were used as the primary isotopic reference materials for the hydrogen isotope system for multiple decades. In 2006 the IAEA Isotope Hydrology Laboratory constructed new isotopic reference materials called VSMOW2 and SLAP2 with nearly identical δ2H and δ18O as VSMOW and SLAP.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
Standard practice is a desiccated container at −20 °C, protected from light and kept sealed between uses. Letting the vial reach room temperature before opening reduces condensation on the powder. Repeated warming and cooling of the whole container is generally avoided.
There is no broadly accepted figure for TB-500. Laboratory practice is short-term storage at 2–8 °C with longer-term aliquots frozen, and degradation is expected to increase with time and temperature. Users typically rely on their own stability checks rather than published data.
Mass measurement provides the clearest confirmation by matching an observed value to the expected one. Reversed-phase chromatography adds a purity estimate through peak integration. Combining both is standard because neither alone establishes identity and purity together.
TB-500 is a trade-style label for a synthetic peptide connected to thymosin beta-4. It is sold mainly through research-chemical channels and is not a single chemically defined product across suppliers.